Skip to content

Home Search Authors Pakistan News Saved

SciRah

SciRah does not host or store research papers. Results come live from free, official scholarly APIs, and every paper links back to its original source.

Data sources

OpenAlex
Semantic Scholar
Crossref
CORE
arXiv
PubMed

Privacy policy Terms of service

Takeshi Akama · SciRah

Researcher profile · Semantic Scholar

Takeshi Akama

Share profile

Takeshi Akama — researcher profile on SciRah

h-index: 19
Works: 46
Citations: 1,057

Most-cited papers

Current status of leprosy: Epidemiology, basic science and clinical perspectives
Koichi Suzuki, Takeshi Akama, A. Kawashima, A. Yoshihara +2 more
2012Journal of dermatology (Print)133 citations Open access
Semantic Scholar
Fibro-Adipogenic Remodeling of the Diaphragm in Obesity-Associated Respiratory Dysfunction
Eric D. Buras, K. Converso-Baran, C. Davis, Takeshi Akama +4 more
2018Diabetes74 citations Open access
Semantic Scholar
Innate immune activation and thyroid autoimmunity.
A. Kawashima, Kazunari Tanigawa, Takeshi Akama, A. Yoshihara +2 more
2011Journal of Clinical Endocrinology and Metabolism70 citations Open access
Semantic Scholar
Whole-Genome Tiling Array Analysis of Mycobacterium leprae RNA Reveals High Expression of Pseudogenes and Noncoding Regions
Takeshi Akama, Koichi Suzuki, Kazunari Tanigawa, A. Kawashima +5 more
2009Journal of Bacteriology64 citations Open access
Semantic Scholar
Expression of adipose differentiation-related protein (ADRP) and perilipin in macrophages infected with Mycobacterium leprae.
Kazunari Tanigawa, Koichi Suzuki, Kazuaki Nakamura, Takeshi Akama +7 more
2008FEMS Microbiology Letters64 citations
Semantic Scholar
Fragments of genomic DNA released by injured cells activate innate immunity and suppress endocrine function in the thyroid.
A. Kawashima, Kazunari Tanigawa, Takeshi Akama, Huhehasi Wu +11 more
2011Endocrinology58 citations Open access
Semantic Scholar
Demonstration of Innate Immune Responses in the Thyroid Gland: Potential to Sense Danger and a Possible Trigger for Autoimmune Reactions
A. Kawashima, K. Yamazaki, T. Hara, Takeshi Akama +9 more
2013Thyroid51 citations Open access
Semantic Scholar
Detection of Mycobacterium leprae DNA from Archaeological Skeletal Remains in Japan Using Whole Genome Amplification and Polymerase Chain Reaction
Koichi Suzuki, W. Takigawa, Kazunari Tanigawa, Kazuaki Nakamura +8 more
2010PLoS ONE43 citations Open access
Semantic Scholar
Regulation of Dual Oxidase Expression and H2O2 Production by Thyroglobulin
A. Yoshihara, T. Hara, A. Kawashima, Takeshi Akama +8 more
2012Thyroid42 citations Open access
Semantic Scholar
Role of thyroglobulin on negative feedback autoregulation of thyroid follicular function and growth.
Koichi Suzuki, A. Kawashima, A. Yoshihara, Takeshi Akama +3 more
2011Journal of Endocrinology42 citations Open access
Semantic Scholar
Pendrin is a novel autoantigen recognized by patients with autoimmune thyroid diseases.
Akio Yoshida, I. Hisatome, Shin-ichi Taniguchi, Y. Shirayoshi +10 more
2009Journal of Clinical Endocrinology and Metabolism39 citations Open access
Semantic Scholar
Leprosy as a model of immunity.
De-Gang Yang, Kazuaki Nakamura, Takeshi Akama, Y. Ishido +3 more
2014Future Microbiology37 citations
Semantic Scholar
Clofazimine Modulates the Expression of Lipid Metabolism Proteins in Mycobacterium leprae-Infected Macrophages
De-Gang Yang, Takeshi Akama, T. Hara, Kazunari Tanigawa +5 more
2012PLoS Neglected Tropical Diseases36 citations Open access
Semantic Scholar
Transcription factor 21 (TCF21) promotes proinflammatory interleukin 6 expression and extracellular matrix remodeling in visceral adipose stem cells
Takeshi Akama, T. Chun
2018Journal of Biological Chemistry31 citations Open access
Semantic Scholar
Tryptophan aspartate‐containing coat protein (CORO1A) suppresses Toll‐like receptor signalling in Mycobacterium leprae infection
Kazunari Tanigawa, Koichi Suzuki, Hiroaki Kimura, F. Takeshita +4 more
2009Clinical and Experimental Immunology30 citations Open access
Semantic Scholar
Propylthiouracil Increases Sodium/Iodide Symporter Gene Expression and Iodide Uptake in Rat Thyroid Cells in the Absence of TSH
M. Sue, Takeshi Akama, A. Kawashima, H. Nakamura +10 more
2012Thyroid28 citations Open access
Semantic Scholar
Identification of microRNAs that mediate thyroid cell growth induced by TSH.
Takeshi Akama, M. Sue, A. Kawashima, Huhehasi Wu +7 more
2012Molecular Endocrinology25 citations Open access
Semantic Scholar
Phosphatidylinositol 3-kinase-binding protein, PI3KAP/XB130, is required for cAMP-induced amplification of IGF mitogenic activity in FRTL-5 thyroid cells.
D. Yamanaka, Takeshi Akama, Toshiaki Fukushima, T. Nedachi +6 more
2012Molecular Endocrinology23 citations Open access
Semantic Scholar
Essential role of hormone-sensitive lipase (HSL) in the maintenance of lipid storage in Mycobacterium leprae-infected macrophages.
Kazunari Tanigawa, De-Gang Yang, A. Kawashima, Takeshi Akama +5 more
2012Microbial Pathogenesis21 citations Open access
Semantic Scholar
Membrane‐Tethered Metalloproteinase Expressed by Vascular Smooth Muscle Cells Limits the Progression of Proliferative Atherosclerotic Lesions
R. H. Barnes, Takeshi Akama, Miina K. Öhman, Moon-sook Woo +4 more
2017Journal of the American Heart Association : Cardiovascular and Cerebrovascular Disease18 citations Open access
Semantic Scholar
Analysis of Mycobacterium leprae gene expression using DNA microarray.
Takeshi Akama, Kazunari Tanigawa, A. Kawashima, Huhehasi Wu +2 more
2010Microbial Pathogenesis16 citations
Semantic Scholar
Improved Oxygen Supply to Multicellular Spheroids Using A Gas-permeable Plate and Embedded Hydrogel Beads
Hirotaka Mihara, Mai Kugawa, Kanae Sayo, Fumiya Tao +5 more
2019Cells15 citations Open access
Semantic Scholar
Thyroglobulin (Tg) activates MAPK pathway to induce thyroid cell growth in the absence of TSH, insulin and serum.
M. Sue, Moyuru Hayashi, A. Kawashima, Takeshi Akama +8 more
2012Biochemical and Biophysical Research Communications - BBRC14 citations
Semantic Scholar
Detection of RNA expression from pseudogenes and non-coding genomic regions of Mycobacterium leprae.
Kazuaki Nakamura, Takeshi Akama, Bang Dang Pham, Shin Sekimura +6 more
2009Microbial Pathogenesis14 citations
Semantic Scholar
The Exocyst Complex Regulates Free Fatty Acid Uptake by Adipocytes
Mayumi Inoue, Takeshi Akama, Yi-Bin Jiang, T. Chun
2015PLoS ONE13 citations Open access
Semantic Scholar
Design of 3-D adipospheres for quantitative metabolic study
Takeshi Akama, Brendan M. Leung, Joseph M. Labuz, S. Takayama +1 more
2017Methods in molecular biology12 citations Open access
Semantic Scholar
A Novel Role for Flotillin-Containing Lipid Rafts in Negative-Feedback Regulation of Thyroid-Specific Gene Expression by Thyroglobulin
Yuqian Luo, Takeshi Akama, Akiko Okayama, A. Yoshihara +8 more
2016Thyroid9 citations Open access
Semantic Scholar
Whole-genome expression analysis of Mycobacterium leprae and its clinical application.
Takeshi Akama, Koichi Suzuki, Kazunari Tanigawa, Kazuaki Nakamura +6 more
2010Japanese journal of infectious diseases (Print)9 citations Open access
Semantic Scholar
Expression of a thyroglobulin (Tg) variant in mouse kidney glomerulus.
Huhehasi Wu, Sayuri Suzuki, D. F. Sellitti, S. Q. Doi +11 more
2009Biochemical and Biophysical Research Communications - BBRC8 citations
Semantic Scholar
Thyroglobulin increases thyroid cell proliferation via the suppression of specific microRNAs.
Takeshi Akama, Yuqian Luo, D. F. Sellitti, A. Kawashima +6 more
2014Molecular Endocrinology7 citations Open access
Semantic Scholar
Phosphatidylinositol 3-Kinase-Associated Protein (PI3KAP)/XB130 Crosslinks Actin Filaments through Its Actin Binding and Multimerization Properties In Vitro and Enhances Endocytosis in HEK293 Cells
D. Yamanaka, Takeshi Akama, K. Chida, S. Minami +3 more
2016Frontiers in Endocrinology6 citations Open access
Semantic Scholar
Regulation of dual oxidase (DUOX) expression and H2O2 production by thyroglobulin
A. Yoshihara, T. Hara, A. Kawashima, Takeshi Akama +8 more
20125 citations
Semantic Scholar
Comprehensive Analysis of Prokaryotes in Environmental Water Using DNA Microarray Analysis and Whole Genome Amplification
Takeshi Akama, A. Kawashima, Kazunari Tanigawa, Moyuru Hayashi +6 more
2013Pathogens3 citations Open access
Semantic Scholar
[Molecular mechanisms for intracellular parasitisation and exclusion in macrophage infected with Mycobacterium leprae].
Kazunari Tanigawa, Koichi Suzuki, A. Kawashima, M. Mishima +4 more
2008Nihon Hansenbyo Gakkai zasshi = Japanese journal of leprosy : official organ of the Japanese Leprosy Association1 citations Open access
Semantic Scholar
Research and human resource development for analysis of fuel debris and decommissioning technology of Fukushima Daiichi nuclear power plants
Takeshi Akama
20200 citations
Semantic Scholar
Improvement of Oxygen Supply to the Multicellular Spheroids Using a Gas-Permeable Plate and Embedded Hydrogel Beads
Hirotaka Mihara, Mai Kugawa, Kanae Sayo, Fumiya Tao +5 more
20190 citations Open access
Semantic Scholar
CP-33 Thyroglobulin (Tg) negatively regulates thyroid follicular function through membrane lipid raft(CJJSHH Poster Session)
Yuqian Luo, Takeshi Akama, Akiko Okayama, Y. Ishido +2 more
20140 citations
Semantic Scholar
Design of tiling arrays and their application to bacterial transcriptome analysis.
Takeshi Akama, Kazuaki Nakamura, A. Tanoue, Koichi Suzuki
2013Methods in molecular biology0 citations
Semantic Scholar
OR02-4 Phosphatidylinositol 3-kinase-binding protein, PI3KAP/XB130 crosslinks actin filaments and regulates cell migration
D. Yamanaka, Takeshi Akama, F. Hakuno, K. Chida +3 more
20120 citations
Semantic Scholar
Thyroglobulin induces thyroid cell growth through suppression of miR-16 and miR-195
Takeshi Akama, T. Hara, D. Yan, A. Kawashima +7 more
20120 citations
Semantic Scholar
P67 PI 3-kinase activation through c-Src-dependent tyrosine phosphorylation of PITKAP/XB130, a novel binding partner of a PI 3-kinase p85 regulatory subunit, plays novel roles in priming cells to IGF
D. Yamanaka, Takeshi Akama, Toshiaki Fukushima, K. Chida +3 more
20100 citations
Semantic Scholar
[Comprehensive analysis of RNA expression of Mycobacterium leprae and clinical and biological significance].
Koichi Suzuki, Kazuaki Nakamura, Kazunari Tanigawa, A. Kawashima +6 more
2009Nihon Hansenbyo Gakkai zasshi = Japanese journal of leprosy : official organ of the Japanese Leprosy Association0 citations Open access
Semantic Scholar
CTGATCAGGACGGTCGGTAT TCTGGCTTCGGTCTCAGTCT CAGATTGGAGCGCATTACCT ATAATCACCTGCGGCATCTT TGGCGTCTGGTGTCAATATC CCAGCATAGTCGAGTCACAGG GACCTTCGAGGATCTGTTCG ATAGACGTCATCGAGCGACA GAACTGTGAAGTGGTTCAACG AGCGAACTCCAGTGGCTTG TTGCTAGTACGGCAACCAGA TGTTGAACAGGACGGTATGG AAGAACACCGCTTGAGTTGG ATGTTCGAGGAACGGTTACG CATCA
Kazuaki Nakamura, Takeshi Akama, Bang Dang Pham, Shin Sekimura +6 more
20090 citations
Semantic Scholar
[Detection of RNA expression on whole genome analysis of Mycobacterium leprae by tiling array].
Takeshi Akama, Koichi Suzuki, Kazunari Tanigawa, A. Kawashima +4 more
2009Nihon Hansenbyo Gakkai zasshi = Japanese journal of leprosy : official organ of the Japanese Leprosy Association0 citations Open access
Semantic Scholar
OR12,2 p125, a novel PI 3-kinase-associated protein (PITKAP) plays an essential role in cAMP-dependent potentiation of IGF bioactivities in a thyroid cell line
D. Yamanaka, Takeshi Akama, Toshiaki Fukushima, Chie Kawasaki +3 more
20080 citations
Semantic Scholar
Expression of adipose di¡erentiation-related protein (ADRP) and perilipin in macrophages infected with Mycobacteriumleprae
Kazunari Tanigawa, Koichi Suzuki, Kazuaki Nakamura, Takeshi Akama +8 more
20080 citations
Semantic Scholar

Frequent co-authors

Invite them to SciRah by sharing their profile.

A. Kawashima×27
Invite
A. Kawashima — researcher profile on SciRah
N. Ishii×26
Invite
N. Ishii — researcher profile on SciRah
Kazunari Tanigawa×26
Invite
Kazunari Tanigawa — researcher profile on SciRah
Huhehasi Wu×20
Invite
Huhehasi Wu — researcher profile on SciRah

×18

Invite

Koichi Suzuki — researcher profile on SciRah

Invite

Y. Ishido — researcher profile on SciRah

A. Yoshihara×16

Invite

A. Yoshihara — researcher profile on SciRah

Koichi Suzuki×12

Invite

Koichi Suzuki — researcher profile on SciRah

Invite

M. Sue — researcher profile on SciRah

Kazuaki Nakamura×10

Invite

Kazuaki Nakamura — researcher profile on SciRah

Moyuru Hayashi×10

Invite

Moyuru Hayashi — researcher profile on SciRah

Invite

T. Hara — researcher profile on SciRah