Skip to content

Home Search Authors Pakistan News Saved

SciRah

SciRah does not host or store research papers. Results come live from free, official scholarly APIs, and every paper links back to its original source.

Data sources

OpenAlex
Semantic Scholar
Crossref
CORE
arXiv
PubMed

Privacy policy Terms of service

Feng-hua Yuan · SciRah

Researcher profile · Semantic Scholar

Feng-hua Yuan

Share profile

Feng-hua Yuan — researcher profile on SciRah

h-index: 12
Works: 18
Citations: 321

Most-cited papers

Transcriptome analysis of the unfolded protein response in hemocytes of Litopenaeus vannamei.
Yi-Hong Chen, Feng-hua Yuan, Hai-Tao Bi, Ze-Zhi Zhang +5 more
2016Fish and Shellfish Immunology38 citations
Semantic Scholar
Heat shock 70 kDa protein cognate 5 involved in WSSV toleration of Litopenaeus vannamei
Kai Yuan, Feng-hua Yuan, Hong-Hui He, Hai-Tao Bi +3 more
2017Developmental and Comparative Immunology37 citations
Semantic Scholar
Integrative network-based analysis on multiple Gene Expression Omnibus datasets identifies novel immune molecular markers implicated in non-alcoholic steatohepatitis
Jun-jie Zhang, Yan Shen, Xiaoyan Chen, Man-lei Jiang +4 more
2023Frontiers in Endocrinology36 citations Open access
Semantic Scholar
Identification and functional characterization of a novel Spätzle gene in Litopenaeus vannamei
Kai Yuan, Feng-hua Yuan, S. Weng, Jian-Guo He +1 more
2017Developmental and Comparative Immunology34 citations
Semantic Scholar
A novel antimicrobial protein isolated from potato (Solanum tuberosum) shares homology with an acid phosphatase.
Jie Feng, Feng-hua Yuan, Yin Gao, Cheng-Gang Liang +3 more
2003Biochemical Journal33 citations Open access
Semantic Scholar
Down-regulation apoptosis signal-regulating kinase 1 gene reduced the Litopenaeus vannamei hemocyte apoptosis in WSSV infection.
Feng-hua Yuan, Yong-gui Chen, Ze-Zhi Zhang, Hai-Tao Yue +5 more
2016Fish and Shellfish Immunology27 citations
Semantic Scholar
Identification and functional characterization of heat shock transcription factor1 in Litopenaeus vannamei.
Hui Yan, Shuang Zhang, Xiao-Yun Li, Feng-hua Yuan +5 more
2014Fish and Shellfish Immunology24 citations Open access
Semantic Scholar
Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.
Yong-gui Chen, Kai Yuan, Ze-Zhi Zhang, Feng-hua Yuan +4 more
2016Developmental and Comparative Immunology19 citations
Semantic Scholar
Identification and functional characterization of an endoplasmic reticulum oxidoreductin 1-α gene in Litopenaeus vannamei.
Ze-Zhi Zhang, Kai Yuan, Hai-Tao Yue, Feng-hua Yuan +4 more
2016Developmental and Comparative Immunology17 citations
Semantic Scholar
Identification and Function of Leucine-Rich Repeat Flightless-I-Interacting Protein 2 (LRRFIP2) in Litopenaeus vannamei
Shuang Zhang, Hui Yan, C. Li, Yi-Hong Chen +4 more
2013PLoS ONE16 citations Open access
Semantic Scholar
A convenient polyculture system that controls a shrimp viral disease with a high transmission rate
Mu-Hua Wang, Yong-gui Chen, Zhong Zhao, S. Weng +20 more
2021Communications Biology15 citations Open access
Semantic Scholar
Flightless-I (FliI) is a potential negative regulator of the Toll pathway in Litopenaeus vannamei.
Shuang Zhang, W. Qiu, Yong-gui Chen, Feng-hua Yuan +4 more
2015Fish and Shellfish Immunology14 citations
Semantic Scholar
Identification and characterization of a mitochondrial unfolded protein response transcription factor ATFS-1 in Litopenaeus vannamei.
Yong-gui Chen, Hai-Tao Yue, Ze-Zhi Zhang, Feng-hua Yuan +5 more
2016Fish and Shellfish Immunology8 citations
Semantic Scholar
Effects of Chinese herbal compound in feed on growth,digestive enzyme and immune-related enzyme activities of Litopennaus vannamei
Feng-hua Yuan
20122 citations
Semantic Scholar
Identification and functional characterization of a glucose regulated protein 94 gene in Litopenaeus vannamei and its responsiveness in WSSV infection.
Hai-Tao Bi, Feng-hua Yuan, Kai Yuan, S. Weng +2 more
2016Molecular Immunology1 citations
Semantic Scholar
Effectively control of viral disease outbreak in shrimp culture system by selective predation
Yong-gui Chen, Mu-Hua Wang, Zhong Zhao, Shao-Ping Weng +16 more
2020bioRxiv0 citations Open access
Semantic Scholar
TGAAGATGGTCGAGGGGTAAGCCG GGCATCAGACCCATCACCCAGAA TACC TTGAAGCCGAAACACAGAGCCA ATCT TACTGTGTTCATTGTGTCATTGG ACGAGTCCGAGTTCAT AGGTTGACGAGGAACA TTGCGCCGTACTCAT GGTCTGTCCGTTCTT ACGGAATTCCCTCCT TGCAACGCATAGACC ACTCTCCTTACGATG CAGACAGGTCTCCAA CCACCTGACTGTACC TACTGACGAGGCAAT CTGGAGGAGGAAACT AGACACTTGGACTCG
Kai Yuan, Feng-hua Yuan, S. Weng, Jian-Guo He +1 more
20160 citations
Semantic Scholar
Effects of dietary photosynthetic bacteria ps2 on growth performance, digestive enzymes and nonspecific immune enzymes of sea bass (Lates calcarifer).
Hei-Zhao Lin, Feng-hua Yuan, Zhuo-Jia Li, Xin Lu +2 more
20100 citations
Semantic Scholar

Frequent co-authors

Invite them to SciRah by sharing their profile.

Jian-Guo He×13
Invite
Jian-Guo He — researcher profile on SciRah
S. Weng×12
Invite
S. Weng — researcher profile on SciRah
Yi-Hong Chen×11
Invite
Yi-Hong Chen — researcher profile on SciRah
Kai Yuan×11
Invite
Kai Yuan — researcher profile on SciRah

×9

Invite

Yong-gui Chen — researcher profile on SciRah

Invite

Hai-Tao Bi — researcher profile on SciRah

Ze-Zhi Zhang×5

Invite

Ze-Zhi Zhang — researcher profile on SciRah

Invite

Hai-Tao Yue — researcher profile on SciRah

Invite

Hui Yan — researcher profile on SciRah

Shuang Zhang×3

Invite

Shuang Zhang — researcher profile on SciRah

Invite

W. Qiu — researcher profile on SciRah

Invite

Mu-Hua Wang — researcher profile on SciRah