Skip to content

Home Search Authors Pakistan News Saved

SciRah

SciRah does not host or store research papers. Results come live from free, official scholarly APIs, and every paper links back to its original source.

Data sources

OpenAlex
Semantic Scholar
Crossref
CORE
arXiv
PubMed

Privacy policy Terms of service

Jonathan S. Schick · SciRah

Researcher profile · Semantic Scholar

Jonathan S. Schick

Share profile

Jonathan S. Schick — researcher profile on SciRah

h-index: 10
Works: 23
Citations: 355

Most-cited papers

The FA pathway counteracts oxidative stress through selective protection of antioxidant defense gene promoters.
W. Du, R. Rani, J. Sipple, Jonathan S. Schick +5 more
2012Blood68 citations Open access
Semantic Scholar
Macrophage Migration Inhibitory Factor Is a Determinant of Hypoxia-Induced Apoptosis in Colon Cancer Cell Lines
K. Yao, S. Shida, M. Selvakumaran, R. Zimmerman +7 more
2005Clinical Cancer Research42 citations Open access
Semantic Scholar
Ultraviolet Light B-Mediated Inhibition of Skin Catalase Activity Promotes Gr-1+CD11b+ Myeloid Cell Expansion
Nicholas J. Sullivan, K. Tober, E. M. Burns, Jonathan S. Schick +6 more
2011Journal of Investigative Dermatology41 citations Open access
Semantic Scholar
Topical Treatment with OGG1 Enzyme Affects UVB‐induced Skin Carcinogenesis †
Brian C. Wulff, Jonathan S. Schick, J. Thomas-Ahner, D. Kusewitt +2 more
2008Photochemistry and Photobiology39 citations
Semantic Scholar
Preventative topical diclofenac treatment differentially decreases tumor burden in male and female Skh-1 mice in a model of UVB-induced cutaneous squamous cell carcinoma.
E. M. Burns, K. Tober, Judith A. Riggenbach, Jonathan S. Schick +4 more
2013Carcinogenesis37 citations Open access
Semantic Scholar
A Multi-parameter Flow Cytometry Analysis Panel to Assess CD163 mRNA and Protein in Monocyte and Macrophage Populations in Hyperinflammatory Diseases
S. Thornton, R. Tan, A. Sproles, Thuy Do +4 more
2019Journal of Immunology28 citations Open access
Semantic Scholar
Celecoxib Reduces the Effects of Acute and Chronic UVB Exposure in Mice Treated with Therapeutically Relevant Immunosuppressive Drugs
Brian C. Wulff, J. Thomas-Ahner, Jonathan S. Schick, T. Oberyszyn
2010International Journal of Cancer24 citations Open access
Semantic Scholar
Inflammation-mediated Notch signaling skews Fanconi Anemia hematopoietic stem cell differentiation
W. Du, S. Amarachintha, J. Sipple, Jonathan S. Schick +2 more
2013Journal of Immunology23 citations Open access
Semantic Scholar
Sex differences in skin carotenoid deposition and acute UVB-induced skin damage in SKH-1 hairless mice after consumption of tangerine tomatoes
R. Kopec, Jonathan S. Schick, K. Tober, K. Riedl +4 more
2015Molecular Nutrition & Food Research20 citations Open access
Semantic Scholar
Fancd2 Is Required for Nuclear Retention of Foxo3a in Hematopoietic Stem Cell Maintenance*
Xiaoli Li, Jie Li, A. Wilson, J. Sipple +2 more
2014Journal of Biological Chemistry17 citations Open access
Semantic Scholar
Concomitant Inactivation of Foxo3a and Fancc or Fancd2 Reveals a Two-Tier Protection from Oxidative Stress-Induced Hydrocephalus
Xiaoli Li, Liang Li, Jie Li, J. Sipple +6 more
2014Antioxidants and Redox Signaling9 citations Open access
Semantic Scholar
Deletion of Fanca or Fancd2 dysregulates Treg in mice.
W. Du, Ozlem Erden, A. Wilson, J. Sipple +6 more
2014Blood6 citations Open access
Semantic Scholar
protection of antioxidant defense gene promoters
W. Du, R. Rani, J. Sipple, Jonathan S. Schick +5 more
20171 citations
Semantic Scholar
Role of CCL19 and CCL21 chemokines in the response of ovarian tumors to platinum-based chemotherapy
M. Selvakumaran, S. Biade, Jonathan S. Schick, M. Marinucci +4 more
20041 citations
Semantic Scholar
Deletion Of Fanca Or Fancd2 Dysregulates Treg Activity and Exacerbates Gvhd In Mice
Ozlem Erden, A. Wilson, J. Sipple, Jonathan S. Schick +4 more
20130 citations
Semantic Scholar
Skews Fanconi Anemia Hematopoietic Stem Inflammation-Mediated Notch Signaling
W. Du, S. Amarachintha, J. Sipple, Jonathan S. Schick +2 more
20130 citations
Semantic Scholar
TGGTGAAATTGCAAGAGCTG CAGACTTCCGTTGGTGGATT Xiap TTGGAACATGGACATCCTCA TGCCCCTTCTCATCCAATAG Hes 1 CCCACCTCTCTCTTCTGACG AGGCGCAATCCAATATGAAC Hey 1 AGCAGTGAGGTGAAGGGAGA AACGGTGAAATCCGTGAGAC Hoxb 4 CTGGATCACAGCCTGGATTT TGGAAGGGAGTGAGCAGTCT Fzd 1 CAAGGTTTACGGGCTCATGT GTAACAGCCGGACAGGAAAA Notch 2 CCTGAACGGG
W. Du, S. Amarachintha, J. Sipple, Jonathan S. Schick +2 more
20130 citations
Semantic Scholar
Enhanced Notch Signaling Skews Hematopoietic Stem Cell Differentiation in Fanconi Anemia Murine Models
W. Du, J. Sipple, Jonathan S. Schick, Q. Pang
20120 citations
Semantic Scholar
Selective Damage to Antioxidant Gene Promoters in FA Cells
W. Du, R. Rani, J. Sipple, Jonathan S. Schick +1 more
20110 citations
Semantic Scholar
Consumption of a tomato carotenoid containing diet reduces UV‐induced inflammation and DNA damage in a Skh‐1 hairless mouse model
R. Kopec, Jonathan S. Schick, K. Tober, Ken M. Riedl +3 more
20110 citations
Semantic Scholar
Abstract 3378: E-cadherin suppresses breast cancer cell growth and interleukin-6 production
Nicholas J. Sullivan, Jonathan S. Schick, Judith A. Riggenbach, K. Tober +2 more
20100 citations
Semantic Scholar
Abstract 4202: Sex disparities in the cutaneous response to acute ultraviolet light exposure
K. Tober, Judith A. Riggenbach, Jonathan S. Schick, Nicholas J. Sullivan +2 more
20100 citations
Semantic Scholar
MacrophageMigration Inhibitory Factor Is a Determinant of Hypoxia-Induced Apoptosis in Colon Cancer Cell
K. Yao, S. Shida, M. Selvakumaran, R. Zimmerman +7 more
20050 citations
Semantic Scholar

Frequent co-authors

Invite them to SciRah by sharing their profile.

J. Sipple×11
Invite
J. Sipple — researcher profile on SciRah
Q. Pang×11
Invite
Q. Pang — researcher profile on SciRah
T. Oberyszyn×8
Invite
T. Oberyszyn — researcher profile on SciRah
W. Du×7
Invite
W. Du — researcher profile on SciRah

×6

Invite

K. Tober — researcher profile on SciRah

Invite

P. Mehta — researcher profile on SciRah

Invite

S. Davies — researcher profile on SciRah

Judith A. Riggenbach×4

Invite

Judith A. Riggenbach — researcher profile on SciRah

Kris A. Steinbrecher×4

Invite

Kris A. Steinbrecher — researcher profile on SciRah

Invite

R. Rani — researcher profile on SciRah

Invite

K. Myers — researcher profile on SciRah

M. Selvakumaran×3

Invite

M. Selvakumaran — researcher profile on SciRah