Skip to content

Home Search Authors Pakistan News Saved

SciRah

SciRah does not host or store research papers. Results come live from free, official scholarly APIs, and every paper links back to its original source.

Data sources

OpenAlex
Semantic Scholar
Crossref
CORE
arXiv
PubMed

Privacy policy Terms of service

Tim A. Hoek · SciRah

Researcher profile · Semantic Scholar

Tim A. Hoek

Share profile

Tim A. Hoek — researcher profile on SciRah

h-index: 8
Works: 19
Citations: 799

Most-cited papers

Dynamics of Translation of Single mRNA Molecules In Vivo
Xiaowei Yan, Tim A. Hoek, R. Vale, M. Tanenbaum
2016Cell465 citations Open access
Semantic Scholar
Single-Molecule Imaging Uncovers Rules Governing Nonsense-Mediated mRNA Decay
Tim A. Hoek, D. Khuperkar, R. Lindeboom, Stijn Sonneveld +4 more
2019Molecules and Cells143 citations Open access
Semantic Scholar
Dissecting the roles of human BUB1 in the spindle assembly checkpoint
Mathijs Vleugel, Tim A. Hoek, E. Tromer, T. Sliedrecht +3 more
2015Journal of Cell Science80 citations
Semantic Scholar
Resource Availability Modulates the Cooperative and Competitive Nature of a Microbial Cross-Feeding Mutualism
Tim A. Hoek, Kevin Axelrod, Tommaso Biancalani, E. Yurtsev +2 more
2016PLoS Biology49 citations Open access
Semantic Scholar
Quantification of mRNA translation in live cells using single-molecule imaging
D. Khuperkar, Tim A. Hoek, Stijn Sonneveld, Bram M. P. Verhagen +2 more
2020Nature Protocols25 citations Open access
Semantic Scholar
Imaging Translation Dynamics of Single mRNA Molecules in Live Cells.
S. Ruijtenberg, Tim A. Hoek, Xiaowei Yan, M. Tanenbaum
2018Methods in molecular biology10 citations Open access
Semantic Scholar
A public–private partnership model for COVID-19 diagnostics
Peter H. L. Krijger, Tim A. Hoek, S. Boersma, Lieke I. P. M. Donders +21 more
2021Nature Biotechnology9 citations Open access
Semantic Scholar
Correction: Resource Availability Modulates the Cooperative and Competitive Nature of a Microbial Cross-Feeding Mutualism
Tim A. Hoek, Kevin Axelrod, Tommaso Biancalani, E. Yurtsev +2 more
2017PLoS Biology9 citations Open access
Semantic Scholar
Isoleucine-to-valine substitutions support cellular physiology during isoleucine deprivation
G. Kok, I. Schene, E. Ilcken, Paula Sobrevals Alcaraz +12 more
2024Nucleic Acids Research8 citations Open access
Semantic Scholar
Trends in building and ductwork airtightness in Spain
Tim A. Hoek
20221 citations
Semantic Scholar
Step 2: RNA extraction and RT-qPCR v1
Peter H. L. Krijger, Tim A. Hoek, S. Boersma, Lieke I. P. M. Donders +21 more
20210 citations Open access
Semantic Scholar
Multiplex SARS-CoV-2 RT-qPCR protocol v1
Peter H. L. Krijger, Tim A. Hoek, S. Boersma, Lieke I. P. M. Donders +21 more
20210 citations Open access
Semantic Scholar
STRIP: Systematic Testing using Robotics and Innovation during Pandemics v1
Peter H. L. Krijger, Tim A. Hoek, S. Boersma, Lieke I. P. M. Donders +21 more
20210 citations Open access
Semantic Scholar
Bead preparation protocol v1
Peter H. L. Krijger, Tim A. Hoek, S. Boersma, Lieke I. P. M. Donders +21 more
20210 citations Open access
Semantic Scholar
Step 1: Swab sample collection v1
Peter H. L. Krijger, Tim A. Hoek, S. Boersma, Lieke I. P. M. Donders +21 more
20210 citations Open access
Semantic Scholar
Visualizing mRNA quality control : Mechanistic insights from translational dynamics
Tim A. Hoek
20210 citations Open access
Semantic Scholar
ATGAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACA AATTTTCTGTCCGTGGAGAGGGTGAAGGTGATGCTACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGG AAAACTACCTGTTCCGTGGCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCA CATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCT
Xiao Yan, Tim A. Hoek, R. Vale, M. Tanenbaum
20160 citations
Semantic Scholar
Environmental quality modulates the cooperative and competitive nature of a microbial cross-feeding mutualism
Tim A. Hoek, Kevin Axelrod, E. Yurtsev, J. Gore
20160 citations
Semantic Scholar
Gedifferentieerd HRM beleid: op weg naar duurzame inzetbaarheid
Tim A. Hoek
20150 citations
Semantic Scholar

Frequent co-authors

Invite them to SciRah by sharing their profile.

M. Tanenbaum×11
Invite
M. Tanenbaum — researcher profile on SciRah
Bram M. P. Verhagen×8
Invite
Bram M. P. Verhagen — researcher profile on SciRah
S. Boersma×8
Invite
S. Boersma — researcher profile on SciRah
Peter H. L. Krijger×6
Invite
Peter H. L. Krijger — researcher profile on SciRah

Lieke I. P. M. Donders

×6

Invite

Lieke I. P. M. Donders — researcher profile on SciRah

Maaike M. C. Broeders×6

Invite

Maaike M. C. Broeders — researcher profile on SciRah

Mark Pieterse×6

Invite

Mark Pieterse — researcher profile on SciRah

Pim W. Toonen×6

Invite

Pim W. Toonen — researcher profile on SciRah

Invite

I. Logister — researcher profile on SciRah

Marjon J. A. M. Verstegen×6

Invite

Marjon J. A. M. Verstegen — researcher profile on SciRah

T. V. van Ravesteyn×6

Invite

T. V. van Ravesteyn — researcher profile on SciRah

Invite

R. Roymans — researcher profile on SciRah