Skip to content

Home Search Authors Pakistan News Saved

SciRah

SciRah does not host or store research papers. Results come live from free, official scholarly APIs, and every paper links back to its original source.

Data sources

OpenAlex
Semantic Scholar
Crossref
CORE
arXiv
PubMed

Privacy policy Terms of service

Bongki Kim · SciRah

Researcher profile · Semantic Scholar

Bongki Kim

Share profile

Bongki Kim — researcher profile on SciRah

h-index: 10
Works: 34
Citations: 556

Most-cited papers

CFTR interacts with ZO-1 to regulate tight junction assembly and epithelial differentiation through the ZONAB pathway
Y. Ruan, Yan Wang, N. D. da Silva, Bongki Kim +5 more
2014Journal of Cell Science119 citations Open access
Semantic Scholar
Regulation of epithelial function, differentiation, and remodeling in the epididymis
S. Breton, Y. Ruan, Yoo-Jin Park, Bongki Kim
2015Asian Journal of Andrology105 citations Open access
Semantic Scholar
The MAPK/ERK-Signaling Pathway Regulates the Expression and Distribution of Tight Junction Proteins in the Mouse Proximal Epididymis
Bongki Kim, S. Breton
2015Biology of Reproduction74 citations Open access
Semantic Scholar
Relative contribution of clear cells and principal cells to luminal pH in the mouse epididymis†
Yoo-Jin Park, M. Battistone, Bongki Kim, S. Breton
2017Biology of Reproduction43 citations Open access
Semantic Scholar
Role of Testicular Luminal Factors on Basal Cell Elongation and Proliferation in the Mouse Epididymis1
Bongki Kim, Jeremy W. Roy, Winnie Shum, N. D. da Silva +1 more
2015Biology of Reproduction36 citations Open access
Semantic Scholar
Bisphenol A affects the maturation and fertilization competence of spermatozoa.
Yoo-Jin Park, Md. Saidur Rahman, Won-Ki Pang, Do-Yeal Ryu +2 more
2020Ecotoxicology and Environmental Safety33 citations
Semantic Scholar
The expression patterns of aquaporin 9, vacuolar H+-ATPase, and cytokeratin 5 in the epididymis of the common vampire bat
M. M. Castro, Bongki Kim, Eric Hill, M. C. Q. Fialho +4 more
2016Histochemistry and Cell Biology23 citations
Semantic Scholar
The Fused Toes Locus Is Essential for Somatic-Germ Cell Interactions That Foster Germ Cell Maturation in Developing Gonads in Mice1
Bongki Kim, Youngha Kim, P. Cooke, U. Rüther +1 more
2011Biology of Reproduction19 citations Open access
Semantic Scholar
Primordial germ cell proliferation is impaired in Fused Toes mutant embryos.
Bongki Kim, Youngha Kim, Rui Sakuma, Chi-Chung Hui +2 more
2011Developmental Biology14 citations Open access
Semantic Scholar
Androgens are essential for epithelial cell recovery after efferent duct ligation in the initial segment of the mouse epididymis†
Bongki Kim, S. Breton
2019Biology of Reproduction11 citations Open access
Semantic Scholar
The expression and localization of V-ATPase and cytokeratin 5 during postnatal development of the pig epididymis
Yun-Jae Park, Ji-Hyuk Kim, Hack-Youn Kim, Hee-Bok Park +6 more
2019Asian-Australasian Journal of Animal Sciences10 citations Open access
Semantic Scholar
The MAPK/ERK signaling pathway regulates the expression and localization of Cx43 in mouse proximal epididymis
Bongki Kim, S. Breton
2022Biology of Reproduction9 citations Open access
Semantic Scholar
Two Regions Within the Proximal Steroidogenic Factor 1 Promoter Drive Somatic Cell-Specific Activity in Developing Gonads of the Female Mouse1
Li-ying Gao, Youngha Kim, Bongki Kim, S. Lofgren +4 more
2011Biology of Reproduction9 citations Open access
Semantic Scholar
Evaluation of rooster semen quality using CBB dye based staining method
S. Kim, Jae-Yeong Lee, Chan-Lan Kim, Y. Ko +1 more
2022Journal of Animal Reproduction and Biotechnology8 citations Open access
Semantic Scholar
Relative contribution of clear cells and principal cells to luminal pH in the mouse epididymis
Yoo-Jin Park, M. Battistone, Bongki Kim, S. Breton
2017Biology of Reproduction8 citations Open access
Semantic Scholar
Development and Differentiation of Epididymal Epithelial Cells in Korean Native Black Goat
Yu-Da Jeong, Yun-Jae Park, Y. Ko, Sung-Soo Lee +5 more
2020Animals7 citations Open access
Semantic Scholar
Distribution pattern of ZO-1 and claudins in the epididymis of vampire bats
M. M. Castro, Bongki Kim, P. Games, Eric Hill +4 more
2020Tissue Barriers7 citations Open access
Semantic Scholar
RUNX transcription factors are essential in maintaining epididymal epithelial differentiation
M. Toriseva, Ida Björkgren, A. Junnila, A. Mehmood +9 more
2024Cellular and Molecular Life Sciences5 citations Open access
Semantic Scholar
Dysregulation of the Acrosome Formation Network by 8-oxoguanine (8-oxoG) in Infertile Sperm: A Case Report with Advanced Techniques
S. Kim, Bongki Kim, Jongsoo Mok, Eun Seo Kim +1 more
2021International Journal of Molecular Sciences4 citations Open access
Semantic Scholar
The Expression and Localization of ZO-1, Claudin 1, and Claudin 4 in the Pig Epididymis
Yun-Jae Park, Bongki Kim
2019Journal of Animal Reproduction and Biotechnology4 citations Open access
Semantic Scholar
Differential expression and localization of tight junction proteins in the goat epididymis
S. Kim, Yu-Da Jeong, Ga-Yeong Lee, Jinwook Lee +5 more
2022Journal of Animal Science and Technology3 citations Open access
Semantic Scholar
Vacuolar H(+)-ATPase is not restricted to clear cells of the epididymal epithelium in cattle
S. Kim, Bongki Kim
2021Journal of Animal Science and Technology2 citations Open access
Semantic Scholar
Ultrasonic Cutting of Frozen Semen Straws to Optimize the Use of Spermatozoa for In Vitro Fertilization
S. Kim, Jae-Yeong Lee, Bongki Kim, Chan-Lan Kim +3 more
2020Animals2 citations Open access
Semantic Scholar
Corrigendum to "Bisphenol A affects the maturation and fertilization competence of Spermatozoa"[Ecotoxicol. Environ. Saf. 196 (2020) 110512].
Yoo-Jin Park, Md. Saidur Rahman, Won-Ki Pang, Do-Yeal Ryu +2 more
2020Ecotoxicology and Environmental Safety1 citations
Semantic Scholar
Abnormal Follicle Development in Fused Toes Mutant Mice.
Bongki Kim, Youngha Kim, J. Jorgensen
20091 citations
Semantic Scholar
Differential expression and localization of tight junction proteins in the goat epididymis 8 9
S. Kim, Yu-Da Jeong, Gaeun Lee, Jinwook Lee +5 more
20220 citations
Semantic Scholar
Vacuolar H ( + )-ATPase is not restricted to clear cells of the 1 epididymal epithelium in cattle 2 3
S. Kim, Bongki Kim
20200 citations
Semantic Scholar
Localization of the gap junction protein, connexin 43, and E‐cadherin/Cadherin‐1 in the proximal mouse epididymis
Bongki Kim, S. Breton
2015Molecular Reproduction and Development0 citations Open access
Semantic Scholar
Running title: Regulation of basal cells by luminal factors
Bongki Kim, Jeremy W. Roy, N. D. da Silva, S. Breton
20140 citations
Semantic Scholar
Luminal testicular factors are essential for the luminalreaching property of basal cells in the mouse epididymis
Bongki Kim, N. D. da Silva, Jeremy W. Roy, Winnie Shum +1 more
20130 citations
Semantic Scholar
GGCTACAACTCGCACCTCCA CCAAGGAACCTGCCATACCG Irx 6 AGCACATCCCAGTTTCTGGTGTCT ACAGCAAAGAGTAGAGGCAGAGGT Fts TTCACCCACTAGTTGATCCCACCT ATGGTTATGGTTCCGCCTCCACTT Ftm TGCAGCGTGTCAGTTGAGATTCCA TATCCTAATGCCTTTGCCCGCTCA Fto TGCGAAGGCTCTGAGGATGAAAGT AATCCTGGTGTCTCGATGTCCCAA Vasa GAGATTGCCTTCAGTACCTATGTG GTGCTTGCCC
Bongki Kim, Youngha Kim, Rui Sakuma, Chi-Chung Hui +2 more
20110 citations
Semantic Scholar
IrxB Cluster Genes Are Essential for Oocyte Integrity and Follicle Health.
Andrew L. Garfoot, Bongki Kim, N. Mason, J. Jorgensen
20110 citations
Semantic Scholar
Six Genes, Including the IrxB Cluster (Irx3, 5, 6), Ftm, Fto, and Fts, Are Required for Germ Cell Progression in Developing Ovaries of Fused Toes Mutant Mice.
Bongki Kim, Youngha Kim, J. Jorgensen
20100 citations
Semantic Scholar
ABNORMAL DEVELOPMENT IN FEMALE GONADS OF FUSED TOES MUTANT MICE
Bongki Kim, Youngha Kim, J. Jorgensen
20070 citations
Semantic Scholar

Frequent co-authors

Invite them to SciRah by sharing their profile.

S. Breton×13
Invite
S. Breton — researcher profile on SciRah
J. Jorgensen×8
Invite
J. Jorgensen — researcher profile on SciRah
S. Kim×8
Invite
S. Kim — researcher profile on SciRah
Yoo-Jin Park×6
Invite
Yoo-Jin Park — researcher profile on SciRah

×6

Invite

Youngha Kim — researcher profile on SciRah

N. D. da Silva×4

Invite

N. D. da Silva — researcher profile on SciRah

Invite

Y. Ko — researcher profile on SciRah

Invite

Eric Hill — researcher profile on SciRah

Jeremy W. Roy×3

Invite

Jeremy W. Roy — researcher profile on SciRah

Invite

U. Rüther — researcher profile on SciRah

Yun-Jae Park×3

Invite

Yun-Jae Park — researcher profile on SciRah

Chan-Lan Kim×3

Invite

Chan-Lan Kim — researcher profile on SciRah